Top » Catalog » SNPs » Y141584

$18.00

Y141584
[Y141584]

Y141584
hg38 Position: ChrY:16573371..16573371
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: E1b
Comments: Below L19
Forward Primer: Y141584_F AAGAGGTTAAAACTTTCAGAGTAGGATG
Reverse Primer: Y141584_R GTGGGGTGGCTAGAGTCTTTC
Reviews

Customers who bought this product also purchased
E1b-L19 Panel
E1b-L19 Panel
Y22558
Y22558
Y190325
Y190325
PF6789
PF6789
MZ247
MZ247
MZ90
MZ90
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies