Top » Catalog » SNPs » L45

$18.00

L45
[L45]

L45
hg38 Position: ChrY:13004225..13004225
Ancestral: T
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a1c2b1a1a1
Comments: .
Forward Primer: L45v2_F TGCTTTCTACAGTGTTTCACTGATG
Reverse Primer: L45v2_R GTGTGCTGTTTGCTAAGACCAC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
L47
L47
L44
L44
L493
L493
U106
U106
Z8
Z8
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies