Top » Catalog » Y SNPs » B405

$18.00

B405
[B405]

B405
hg38 Position: ChrY:6906292..6906292
Ancestral: A
Derived: C
Reference: Karmin et al. (2015)
ISOGG Haplogroup: E1b1b1b2a1a4d2b~
Comments: Below Y6938
Forward Primer: B405_F TCTCTTTGCCTACTGCCATTC
Reverse Primer: B405_R CTGCAGAGGGCTGTGATAAAC
Reviews (1)

Customers who bought this product also purchased
Y4970
Y4970
Y15937
Y15937
BY165218
BY165218
Y6938
Y6938
BY141576
BY141576
Y194370
Y194370
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies