Top » Catalog » SNPs » A7020

$18.00

A7020
[A7020]

A7020
hg38 Position: ChrY:16959815..16959815
Ancestral: G
Derived: A
Reference: Vladimir Tagankin (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: A7020_F GTACTAAAAGTCTCTGATAAGCAGAAATAAC
Reverse Primer: A7020_R CCTGATTGCTCTGACTAAAACTTC
Reviews

Customers who bought this product also purchased
Y30194
Y30194
YP237
YP237
Y10802
Y10802
Y33
Y33
YP6001
YP6001
Z91
Z91
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies