Top » Catalog » SNPs » Z6049

$18.00

Z6049
[Z6049]

Z6049
hg38 Position: ChrY:13671304..13671304
Ancestral: G
Derived: A
Reference: Y DNA community
ISOGG Haplogroup: J2 (not listed)
Comments: Approx. hg: J-M410
Forward Primer: Z6049_F AGAAACCCTGGAAGGTCCTC
Reverse Primer: Z6049_R CTCATCCAGGAGGCACAGAG
Reviews

Customers who bought this product also purchased
PF5088
PF5088
Y28883
Y28883
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Y28886
Y28886
CTS7683
CTS7683
Y8531
Y8531
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies