Top » Catalog » SNPs » A7042

$18.00

A7042
[A7042]

A7042
hg38 Position: ChrY:19272367..19272367
Ancestral: G
Derived: A
Reference: Col John D Heavey (2015)
ISOGG Haplogroup: R1b1a2a1a2c1f
Comments: Downstream Z253 > Z2534 > Z2185
Forward Primer: A7042_F ATGTGGCCTCACTCTGGTTC
Reverse Primer: A7042_R CACTCAGGGCATTCTAGCAAC
Reviews

Customers who bought this product also purchased
A7036
A7036
A7041
A7041
A7028
A7028
A7047
A7047
A7035
A7035
A7040
A7040
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies