Top » Catalog » SNPs » A7045

$19.00

A7045
[A7045]

A7045
hg38 Position: ChrY:19762955..19762955
Ancestral: G
Derived: C
Reference: Col John D Heavey (2015)
ISOGG Haplogroup: R1b1a2a1a2c1f
Comments: Downstream Z253 > Z2534 > Z2185
Forward Primer: A7045_F ACAGTGGCAGCACACTATGG
Reverse Primer: A7045_R CCCCATTTGCTGGTGTATG
Reviews

Customers who bought this product also purchased
R1b-Z2185 HEAVEY Family Segregation Panel
R1b-Z2185 HEAVEY Family Segregation Panel
A7043
A7043
A7030
A7030
A7049
A7049
A7037
A7037
A7042
A7042
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies