Top » Catalog » SNPs » A196

$18.00

A196
[A196]

A196
hg38 Position: ChrY:15141469..15141469
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: I1a2a1a3
Comments: Downstream I1-Z140
Forward Primer: A196_F TCAGGGATTTTTAGCCAACAG
Reverse Primer: A196_R TAGTGATCCCATTGGGGTTG
Reviews

Customers who bought this product also purchased
Z2535
Z2535
Z138
Z138
BY477
BY477
A5924
A5924
A1374
A1374
A1603
A1603
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies