Top » Catalog » SNPs » Y9078

$18.00

Y9078
[Y9078]

Y9078
hg38 Position: ChrY:17079852..17079852
Ancestral: G
Derived: T
Reference: Yfull (2015)
ISOGG Haplogroup: R1a-S7759
Comments: .
Forward Primer: Y9078_F CTGCCTCAGGAGAGTAACAGG
Reverse Primer: Y9078_R TGGTTTCTCTCACGTGCAAC
Reviews

Customers who bought this product also purchased
Y9079
Y9079
YP1191
YP1191
Y9077
Y9077
YP1190
YP1190
Y9076
Y9076
YP1189
YP1189
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies