Top » Catalog » SNPs » YP1190

$18.00

YP1190
[YP1190]

YP1190
hg38 Position: ChrY:15998972..15998972
Ancestral: A
Derived: C
Reference: Yfull (2015)
ISOGG Haplogroup: R1a1a1b1a3 (not listed)
Comments: Downstream S7759 > YP1187
Forward Primer: YP1190_F CTTGCACTTGCTCCATGTTC
Reverse Primer: YP1190_R TGGGGCAAGAATCAGAGC
Reviews

Customers who bought this product also purchased
YP1193
YP1193
R1a-Y9073 Mortzell panel
R1a-Y9073 Mortzell panel
Y9078
Y9078
YP1191
YP1191
Y9077
Y9077
YP1189
YP1189
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies