Top » Catalog » SNPs » YP1191

$18.00

YP1191
[YP1191]

YP1191
hg38 Position: ChrY:19859148..19859148
Ancestral: A
Derived: G
Reference: Yfull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream Y9073
Forward Primer: YP1191_F AGTTCCTGTTTGGTTCTCAGC
Reverse Primer: YP1191_R GGAAATTTCAAAAGGGAGGATG
Reviews

Customers who bought this product also purchased
Y9077
Y9077
YP1189
YP1189
Y9076
Y9076
YP1188
YP1188
Y9075
Y9075
YP1186
YP1186
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies