Top » Catalog » SNPs » YP1696

$18.00

YP1696
[YP1696]

YP1696
hg38 Position: ChrY:13474331..13474331
Ancestral: T
Derived: G
Reference: YDNA-community (2015)
ISOGG Haplogroup: R1a
Comments: Downstream YP683
Forward Primer: YP1696_F GTTGCAGTGGGCTGACATAG
Reverse Primer: YP1696_R GATTGGTGCATTACCTGTTTCTC
Reviews

Customers who bought this product also purchased
YP6187
YP6187
Z92
Z92
YP1698
YP1698
R1a-Z280 Panel
R1a-Z280 Panel
Y11268
Y11268
BY182582
BY182582
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies