Top » Catalog » SNPs » M35

$18.00

M35
[M35]

M35
hg38 Position: ChrY:19579817..19579817
Ancestral: G
Derived: C
Reference: Underhill et al. 2001
ISOGG Haplogroup: E1b1b1
Comments: G to C to T Tri-allelic SNP
Forward Primer: M35_F CCAGGAAAAAGAGAAGTATTAAGCC
Reverse Primer: M35_R TTTTGCCATATGGAGAGCTG
Reviews

Customers who bought this product also purchased
ZS4753
ZS4753
M81
M81
M267
M267
M123
M123
M78
M78
M84
M84
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies