Top » Catalog » SNPs » A294

$18.00

A294
[A294]

A294
hg38 Position: ChrY:7403755..7403755
Ancestral: G
Derived: T
Reference: Charles Moore (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1b1a2
Comments: .
Forward Primer: A294_F GGGGATGGAAGAGTGAAATG
Reverse Primer: A294_R CCTGAGTCATGTGCAAGCAG
Reviews

Customers who bought this product also purchased
L48
L48
A6389
A6389
U106
U106
CTS6365
CTS6365
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
A8151
A8151
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies