Top » Catalog » SNPs » rs2402130



hg38 Position: Chr14:92334859..92334859
Ancestral: A
Derived: G
Reference: dbSNP
ISOGG Haplogroup: .
Comments: SLC24A4
Forward Primer: rs2402130v2_F AGACGTGAGGGTTTGAGTCC
Reverse Primer: rs2402130v2_R AGCACCTGCCTTCAGAGTTG

Customers who bought this product also purchased
Quick Find
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products