Top » Catalog » SNPs » FGC12352

$18.00

FGC12352
[FGC12352]

FGC12352
hg38 Position: ChrY:3039524..3039524
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC12352_F TGCATGCCTGCATCAAAC
Reverse Primer: FGC12352_R GGGCTAACATGTCTCTGGATG
Reviews

Customers who bought this product also purchased
FGC12359
FGC12359
S17693
S17693
FGC12364
FGC12364
FGC12374
FGC12374
FGC12355
FGC12355
S16857
S16857
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies