Top » Catalog » SNPs » FGC57150

$18.00

FGC57150
[FGC57150]

FGC57150
hg38 Position: ChrY:9992208..9992208
Ancestral: T
Derived: C
Reference: Full genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: Below FGC11 > Y5321 > Y20903
Forward Primer: FGC57150_F GTTATAAATTTCTGTGTGGTGCAATAC
Reverse Primer: FGC57150_R TGGGGATGGCAAGATACCA
Reviews

Customers who bought this product also purchased
Y20902
Y20902
FGC1
FGC1
ZS10633
ZS10633
FGC2
FGC2
FGC44943
FGC44943
FGC1707
FGC1707
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies