Top » Catalog » SNPs » BY453

$18.00

BY453
[BY453]

BY453
hg38 Position: ChrY:8549988..8549988
Ancestral: A
Derived: G
Reference: FTDNA (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: BY453v2_F CATCTTTGGACTTTATCCTAGGATG
Reverse Primer: BY453v2_R AATCATTGAGCCAGACATAGGG
Reviews

Customers who bought this product also purchased
A20878
A20878
BY4761
BY4761
A10699
A10699
FT309123
FT309123
Y6232
Y6232
FT234605
FT234605
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies