Top » Catalog » SNPs » YFS251206

$18.00

YFS251206
[YFS251206]

YFS251206
hg38 Position: ChrY:9041507..9041507
Ancestral: A
Derived: C
Reference: Yfull (2015)
ISOGG Haplogroup: I1a2a1a1a1
Comments: Downstream S2000
Forward Primer: YFS251206_F TCTTTGCATATTTTCAGAGCAAAG
Reverse Primer: YFS251206_R TGACTGGCCTAAGGCACC
Reviews (1)

Customers who bought this product also purchased
S2000
S2000
S1961
S1961
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies