Top » Catalog » SNPs » FGC6418

$19.00

FGC6418
[FGC6418]

FGC6418
hg38 Position: ChrY:8445117..8445117
Ancestral: G
Derived: A
Reference: FullGenomes Corp (2013)
ISOGG Haplogroup: R1b (not listed)
Comments: Found in a R1b-U152/Z36 person and NA12144
Forward Primer: FGC6418_F CATTCATTGTAAAAATCAGACAGAAGA
Reverse Primer: FGC6418_R TCTCTTTGTCCTGAATTGTACCAAT
Reviews

Customers who bought this product also purchased
BY54584
BY54584
BY3631
BY3631
BY65966
BY65966
FTA17505
FTA17505
FT249048
FT249048
FTA10243
FTA10243
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies