Top » Catalog » SNPs » A1596

$18.00

A1596
[A1596]

A1596
hg38 Position: ChrY:14401047..14401047
Ancestral: C
Derived: A
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ [13] Branch
Forward Primer: A1596_F CCTGGAATGAGAAAATGTTTAAGAAC
Reverse Primer: A1596_R CATGACACAAGAAACTGCTCAG
Reviews (1)

Customers who bought this product also purchased
A1615
A1615
A10700
A10700
A1614
A1614
I1-A1605 Crawford Core Segregation Panel
I1-A1605 Crawford Core Segregation Panel
A1613
A1613
A1612
A1612
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies