Top » Catalog » SNPs » DF96

$18.00

DF96
[DF96]

DF96
hg38 Position: ChrY:15623928..15623928
Ancestral: A
Derived: G
Reference: Grierson (2013)
ISOGG Haplogroup: R1b1a1a2a1a1c1a2
Comments: Aka S1809; found in L1+ samples. Recommend testing in Z304+L1-
Forward Primer: DF96_F AAAGTCACTCTAGTGTCTGAAGTGTG
Reverse Primer: DF96_R AACATACAGGTATAGCATTATGCCTC
Reviews

Customers who bought this product also purchased
A9580
A9580
Y18100
Y18100
Z2560
Z2560
S4234
S4234
A11366
A11366
FT37828
FT37828
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies