Top » Catalog » SNPs » FGC13326

$18.00

FGC13326
[FGC13326]

FGC13326
hg38 Position: ChrY:20444832..20444832
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c1a2b
Comments: Below Z381. approx. DF96
Forward Primer: FGC13326_F GACCCCTTCTCTCTATCTTCCTAG
Reverse Primer: FGC13326_R CAGGGTACATTGACGTCTTGTG
Reviews

Customers who bought this product also purchased
BY128969
BY128969
FGC8410
FGC8410
FGC23212
FGC23212
A14207
A14207
Y129096
Y129096
R1b-FGC13326* to Terry
R1b-FGC13326* to Terry
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies