Top » Catalog » SNPs » A7660

$18.00

A7660
[A7660]

A7660
hg38 Position: ChrY:7050570..7050570
Ancestral: G
Derived: A
Reference: James Kane (2015)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1c
Comments: Downstream of A88
Forward Primer: A7660_F GATGGCGCATGCCTATAATC
Reverse Primer: A7660_R TCCGCGAATATTTTGTTTCC
Reviews

Customers who bought this product also purchased
A2220
A2220
Z16259
Z16259
A88
A88
A195
A195
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
A89
A89
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies