Top » Catalog » SNPs » Y6644

$18.00

Y6644
[Y6644]

Y6644
hg38 Position: ChrY:13842873..13842873
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2a1b2a3 (not listed)
Comments: Below L1317 > Y6647.
Forward Primer: Y6644_F TCGTAAGGCCAGTCTTCTGTC
Reverse Primer: Y6644_R TTATCCAGTCTTGGGCAGTTC
Reviews

Customers who bought this product also purchased
CTS10100
CTS10100
Y5282
Y5282
HVR2
HVR2
Y110378
Y110378
M223
M223
Z161
Z161
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies