Top » Catalog » SNPs » MZ12

$18.00

MZ12
[MZ12]

MZ12
hg38 Position: ChrY:13720848..13720848
Ancestral: T
Derived: G
Reference: E-M81 community (2015)
ISOGG Haplogroup: E1b1b1b1a
Comments: Downstream MZ11
Forward Primer: MZ12_F TCCCAAAATGCTGGGATC
Reverse Primer: MZ12_R AGGGAAATCTCTGTGCATGG
Reviews

Customers who bought this product also purchased
A930
A930
MZ284
MZ284
M81
M81
BY8888
BY8888
MZ90
MZ90
M5011
M5011
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies