Top » Catalog » SNPs » A104

$18.00

A104
[A104]

A104
HG19 Position: ChrY:14937372..14937372
Ancestral: G
Derived: T
Reference: Stewart (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i6a~
Comments: Found in 2 persons of the 1013 cluster
Forward Primer: A104_F TGCTCTCAGATGCATTGCTAC
Reverse Primer: A104_R GCATGTTCCTGACTGTGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies