Top » Catalog » SNPs » YFS446299

$18.00

YFS446299
[YFS446299]

YFS446299
hg38 Position: ChrY:8114001..8114001
Ancestral: T
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: N1c1a1a1a1a2a4b (not listed)
Comments: Below Y10756 > PH547 > Z35246
Forward Primer: YFS446299_F CTTAGCATAGCCTTAATATTGATAGTGAG
Reverse Primer: YFS446299_R TTATTACATGTTTGCCAAAACCC
Reviews

Customers who bought this product also purchased
YFS446310
YFS446310
YFS446329
YFS446329
YFS446307
YFS446307
YFS446320
YFS446320
YFS446297
YFS446297
YFS446319
YFS446319
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies