Top » Catalog » SNPs » Y2933

$18.00

Y2933
[Y2933]

Y2933
hg38 Position: ChrY:7271977..7271977
Ancestral: T
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: Approx E1b1b1b2a1a4~ (not listed)
Comments: Downstream of E-M34 > Z841 > CTS2525/Z849, equiv with CTS1727, CTS1901
Forward Primer: Y2933_F TGTGAGTCACTGCGCTCG
Reverse Primer: Y2933_R GCTTTGAAAGGATCACAAAAATC
Reviews

Customers who bought this product also purchased
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
PF6748
PF6748
CTS4483
CTS4483
L335
L335
FT97053
FT97053
M96
M96
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies