Top » Catalog » SNPs » M84

$18.00

M84
[M84]

M84
hg38 Position: ChrY:19736469..19736477
Ancestral: ins
Derived: del
Reference: Underhill et al.
ISOGG Haplogroup: E1b1b1b2a1a
Comments: G65278.1
Forward Primer: M84_F TCACAAACCTGGGAAAATGG
Reverse Primer: M84_R AGTGGGAAACAGCCTCAATG
Reviews

Customers who bought this product also purchased
Y160200
Y160200
Y18691
Y18691
PF6751
PF6751
BY57152
BY57152
Y5420
Y5420
S11387
S11387
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies