Top » Catalog » SNPs » Z16254

$18.00

Z16254
[Z16254]

Z16254
hg38 Position: ChrY:15735614..15735615
Ancestral: ins
Derived: del
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a2
Comments: downstream of CTS4466
Forward Primer: Z16254_F ACAGGGATCCGTCTTTTGTG
Reverse Primer: Z16254_R GGAACGAGGGAGGGATAGC
Reviews

Customers who bought this product also purchased
Y878
Y878
R1b-A761 Panel
R1b-A761 Panel
A12592
A12592
A12591
A12591
A12589
A12589
A12596
A12596
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies