Top » Catalog » SNPs » FGC5251

$19.00

FGC5251
[FGC5251]

FGC5251
hg38 Position: ChrY:6859145..6859145
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC5251_F TTGCCTGTTCATTCAGATAATAGG
Reverse Primer: FGC5251_R GATACGTAGACTAATGGAACAAAACAC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Prepaid Return Envelope
Prepaid Return Envelope
Mail Tracking
Mail Tracking
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies