Top » Catalog » SNPs » FT188221

$18.00

FT188221
[FT188221]

FT188221
hg38 Position: ChrY:16590726..16590726
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below FGC32556
Forward Primer: FT188221_F CTAGGACACAGGCATGTGTAACA
Reverse Primer: FT188221_R GGTCTTTATAGCAGAATGATTTGTAATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies