Top » Catalog » SNPs » Y34542

$18.00

Y34542
[Y34542]

Y34542
hg38 Position: ChrY:11843042..11843042
Ancestral: G
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: T
Comments: Below M70 > P77 > Y5676 > Y8849
Forward Primer: Y34542_F CTTCTAAATTAGTGTTGCCATCCTG
Reverse Primer: Y34542_R GTAGTCCTGGCTACTCAGGAGGT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies