Top » Catalog » SNPs » A430

$18.00

A430
[A430]

A430
hg38 Position: ChrY:8316158..8316158
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A430_F GCTCACAGCAGCTTAGAACACC
Reverse Primer: A430_R GACACACTCTACAACATTCAGAGTG
Reviews

Customers who bought this product also purchased
A1154
A1154
R1b-Z255 Panel
R1b-Z255 Panel
A816
A816
A1247
A1247
Z16434
Z16434
Z16437
Z16437
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A4634
$18.00
Haplogroup Info
Other products
Currencies