Top » Catalog » SNPs » Y31162

$18.00

Y31162
[Y31162]

Y31162
hg38 Position: ChrY:15844243..15844243
Ancestral: C
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: J2
Comments: Below L26 > Z6065 > YP879
Forward Primer: Y31162_F AGCTGGAGGCATCATGCTG
Reverse Primer: Y31162_R TGAATCATATCCAAAAGCTCAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies