Top » Catalog » SNPs » Y162056

$18.00

Y162056
[Y162056]

Y162056
hg38 Position: ChrY:19005183..19005183
Ancestral: T
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: E
Comments: .
Forward Primer: Y162056_F GATAATTTGAGGTCAGGAGCTCC
Reverse Primer: Y162056_R ACCCTCATAACCTGCCAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS464X
$19.00
Haplogroup Info
Other products
Currencies