Top » Catalog » SNPs » PF2581

$18.00

PF2581
[PF2581]

PF2581
hg38 Position: ChrY:13928083..13928083
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: E
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF2581_F AAGTCAAATTAGGCTATGAATTGAAAAC
Reverse Primer: PF2581_R GGTGATTATGTTGATTAAACAAACTTAGAG
Reviews

Customers who bought this product also purchased
MZ89
MZ89
M5043
M5043
MZ143
MZ143
A930
A930
FGC22844
FGC22844
Z5009
Z5009
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies