Top » Catalog » SNPs » A493

$18.00

A493
[A493]

A493
hg38 Position: ChrY:13084436..13084436
Ancestral: C
Derived: G
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b2a1~
Comments: Downstream of CTS5966
Forward Primer: A493_F AAGGTGGCAAAACACCTGTC
Reverse Primer: A493_R GAGGCAGGAAACATCAAACC
Reviews

Customers who bought this product also purchased
PH908
PH908
CTS10228
CTS10228
Y6658
Y6658
A22782
A22782
A8740
A8740
I2a-M423 Panel
I2a-M423 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies