Top » Catalog » SNPs » A493

$18.00

A493
[A493]

A493
hg38 Position: ChrY:13084436..13084436
Ancestral: C
Derived: G
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b2a1~
Comments: Downstream of CTS5966
Forward Primer: A493_F AAGGTGGCAAAACACCTGTC
Reverse Primer: A493_R GAGGCAGGAAACATCAAACC
Reviews

Customers who bought this product also purchased
Z16983
Z16983
FT14506
FT14506
Y6651
Y6651
BY170650
BY170650
Y32084
Y32084
PH908
PH908
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies