Top » Catalog » SNPs » Y18100

$18.00

Y18100
[Y18100]

Y18100
hg38 Position: ChrY:19500286..19500286
Ancestral: G
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > Z156
Forward Primer: Y18100_F TGAAGGTGGGGAGTACAAGC
Reverse Primer: Y18100_R GAAACACAGTCAGGGTGTGC
Reviews

Customers who bought this product also purchased
DF96
DF96
FGC39801
FGC39801
Z381
Z381
Z306
Z306
FGC11662
FGC11662
Z18
Z18
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies