Top » Catalog » SNPs » A8613

$18.00

A8613
[A8613]

A8613
hg38 Position: ChrY:12913822..12913822
Ancestral: A
Derived: G
Reference: Dennis Waters (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: A8613_F CAGAAATTGCGACAGATACAGC
Reverse Primer: A8613_R TTCATCCCAAGGATCCAAAG
Reviews

Customers who bought this product also purchased
FGC12374
FGC12374
FGC12354
FGC12354
S16857
S16857
FGC12363
FGC12363
S24868
S24868
FGC12367
FGC12367
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies