Top » Catalog » SNPs » FGC12355

$18.00

FGC12355
[FGC12355]

FGC12355
hg38 Position: ChrY:8123956..8123956
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: FGC12355_F TATTTTGCAGTAAAGCAGCGG
Reverse Primer: FGC12355_R GCCTGTTACATGGTCAGACAG
Reviews

Customers who bought this product also purchased
FGC12366
FGC12366
L93
L93
A8616
A8616
A8613
A8613
A8618
A8618
FGC12365
FGC12365
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies