Top » Catalog » SNPs » BY186550

$18.00

BY186550
[BY186550]

BY186550
hg38 Position: ChrY:8125493..8125493
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY186550_F AGAAATTCTGAGCGGGACATC
Reverse Primer: BY186550_R GGAACCATGAATGTAAAAGATTGC
Reviews

Customers who bought this product also purchased
BY35549
BY35549
FGC19909
FGC19909
BY14436
BY14436
BY4060
BY4060
BY9
BY9
Y21752
Y21752
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies