Top » Catalog » SNPs » A6503

$18.00

A6503
[A6503]

A6503
hg38 Position: ChrY:21821760..21821760
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF13 > DF21 > S5488
Forward Primer: A6503_F GGTCAACCTGGCAAATTTC
Reverse Primer: A6503_R CGTCTCTTTTGCTCTCTGAAATCT
Reviews

Customers who bought this product also purchased
A6484
A6484
A6496
A6496
A6502
A6502
R1b-S5488 Jamieson Panel
R1b-S5488 Jamieson Panel
A6495
A6495
A6501
A6501
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies