Top » Catalog » SNPs » Y7829

$18.00

Y7829
[Y7829]

Y7829
hg38 Position: ChrY:8566603..8566603
Ancestral: C
Derived: T
Reference: Yfull (2015)
ISOGG Haplogroup: I2-Y7153
Comments: Below CTS1977> Y4946 > Y7153. Aka FGC29319.
Forward Primer: Y7829_F CAGGCTTGGCTTGATTTTTC
Reverse Primer: Y7829_R CATCTGCAAGAGGCTGTGTG
Reviews

Customers who bought this product also purchased
A11212
A11212
Y7828
Y7828
A11211
A11211
Y7825
Y7825
A11210
A11210
I2a-Y7829 Royce Panel
I2a-Y7829 Royce Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies