Top » Catalog » SNPs » S5668

$18.00

S5668
[S5668]

S5668
hg38 Position: ChrY:2832228..2832228
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b1
Comments: Upstream of L193.1 and downstream from L513
Forward Primer: S5668_F AGCAATGAACATCCAAAAAGTG
Reverse Primer: S5668_R TTTTGAAACCGGGAAGTGTG
Reviews

Customers who bought this product also purchased
Z17294
Z17294
Z17296
Z17296
FGC32837
FGC32837
A8
A8
FGC32836
FGC32836
Z16340
Z16340
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies