Top » Catalog » SNPs » FGC9692

$18.00

FGC9692
[FGC9692]

FGC9692
hg38 Position: ChrY:14818988..14818988
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream R-DF13
Forward Primer: FGC9692_F CAGTGTGCTTTCCAGTGATGA
Reverse Primer: FGC9692_R CCTTCCTTGAGCAGCTACAAG
Reviews

Customers who bought this product also purchased
FGC9670
FGC9670
FGC9683
FGC9683
FGC9695
FGC9695
R1b-S1051 McCeney Panel
R1b-S1051 McCeney Panel
S11111
S11111
FGC9682
FGC9682
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies