Top » Catalog » SNPs » A4611

$18.00

A4611
[A4611]

A4611
hg38 Position: ChrY:12881328..12881328
Ancestral: C
Derived: A
Reference: William Hartley (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream DF13 > S1051
Forward Primer: A4611_F AATTACTGAGCCTCAGGCATTC
Reverse Primer: A4611_R AGCTCACTGCAATCTCCTCG
Reviews

Customers who bought this product also purchased
A4603
A4603
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A4676
1 x A2089
1 x A19263
$54.00
Haplogroup Info
Other products
Currencies