Top » Catalog » SNPs » A4625

$18.00

A4625
[A4625]

A4625
hg38 Position: ChrY:16643679..16643679
Ancestral: T
Derived: C
Reference: William Hartley (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream DF13 > S1051
Forward Primer: A4625_F GGGTCTCTTTGCTGTAAGGC
Reverse Primer: A4625_R GCAAAGTAAGCCCACCCTG
Reviews

Customers who bought this product also purchased
A4615
A4615
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A3379
1 x A425
1 x A4610
1 x A193
$72.00
Haplogroup Info
Other products
Currencies